-
Citation
O'Kane, K.C., The Effect of Inverse Document Frequency Weights on Indexed Sequence Retrieval,
Online Journal of Bioinformatics, Volume 6 (2) 162-173, 2005.
Full Text
-
Abstract
This software presents a method to identify weighted n-gram sequence fragments in large
genomic databases whose indexing characteristics permits the construction of fast,
indexed, sequence retrieval programs where query processing time is determined mainly by
the size of the query and number of sequences retrieved rather than, as is the case in
sequential scan based systems such as BLAST, FASTA, and Smith-Waterman, the size of the
database. The weighting scheme is based on the inverse document frequency (IDF) method,
a weighting formula that calculates the relative importance of indexing terms based on term
distribution. In experiments (see citation above), the relative IDF weights of all segmented, overlapping,
fixed n-grams of length eleven in the NCBI .nt. and other databases were calculated and
the resulting n-grams ranked and used to create an inverted index into the sequence file.
The system was evaluated on test cases constructed from randomly selected known sequences which
were randomly fragmented and mutated and the results compared with BLAST and MegaBlast
for accuracy and speed. Due to the speed of query processing, the system is also capable of
database sequence clustering, examples of which are given below.
-
General Comments
This software is mainly aimed at Linux users.
This code has been developed under the Mint/Mate Linux distro.
-
Distributions
The full IDF distribution is to be found in::
-
Example
The example shows a search for a randomly modified known sequence (exact match) in the gbpri* database.
The IDF Score column gives the IDF metric of similarity. The Fasta results (W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448)
are the result of running the same query sequence against the original gbpri input database.
Sequence Searcher Tue Sep 25 13:50:31 2018
Database files:
/media/okane/ssd120/IDF-New/inputSequences/nt,old
/media/okane/ssd120/work/words.merged,old
Query:
>gi | AC192344.3 | AC192344 | Pan troglodytes BAC clone CH251-157M8 fr 1531378284
GAATTCTCATACGCTGCTTGTGGGAATGTAAAATGGTGCCACCACTTTGGACAAACAGTCTGACAGTTTCTCAAATGGTTA
AACATAGAGTTAACCTATGATTCAGGAATTCTACTCCAATGTATATACACACAGGAAATGGAAACATATGTCAACGCAAAA
ACATATTCATGAGCAACATTATTTATAATAGCCAGAAGGGTGGAAACTACTTCATTTTTTTCAACCAAACACAGGATTAAA
AAATTGTGATATATCCTTAGACTGGAATATGATTTAGCCATAAAAGAGAATGAAGTACTGGTATATGCTGCAATATGAATA
AACCTTGAAAATATTATGCTAAGTGAAACAGACCAGTCACTAAAGATGTATGATTCCATCTTATATGAAACATCACGGATA
GACAAATCTGCTTAGAGCTGACTGGGATGGGGAGATTGGGCAATAGCTAAAGAGTACAGGGTTTTGGTTCTTTTTTTGAGG
TGACAAAAATGCTCAAAATTGAATGTAGTGATGGTTGCCCATATCTCTGAATATACAAAAAGCCATTGAACTGTGCACTTT
ACGTGCATGAATTGCATGGTATGTGAACTACACCTTAATGAAGCTGGTATAAAATTTTTAATTTAGTGCCCGTTCTACAGA
TTATAACATGCATAATCAACATATTACTGTTTAGTTTAAATGAATGCTTTTATCATTTCTTGAGCAACCTAATAACTTCAT
AACCTTTTTTTGAGACAGGGTCTCACTCTGTCGCCCAGGCTGTATTGCAGTGGTGTGATCACAGCTCACTGCACTTTTGAC
CTCCTGGGCTTAAGTGGTCCTCCCACCTCAGCCTCCTGAGTAGTTAGGACTACAAGTGTACATCACCATGCCTGGCTAATT
TTTGTAGATACAGAGTCTCGCTATATTGCCCAGGCTGGGTCTCAAACTCCTGGGACTCAAGCAATCCATCTGCCTGCAGCC
TCTCAAAGTGCTGGGATTACAAGTGTGAGCCATTGCACCCTGGTTCTTTATAACTCAACTCCATTTGTTCTCCTTCTACAT
TTTTGTGTTACTGACATCAATATTTACTTCTTCATATATTTAAAATTTTATGAGGATATATTAAAGTTATCATTTCAAACC
CTAAGGAAAGTATACATTTAGATTTAGTCACATATTCTTCCCAGTGCTTTTAATTTCTTCTTGAATTATTCTATCT
IDF Results:
IDF: 3795 >gi | AL133329.11 | AL133329 | Human DNA sequence from clone RP11-524P
IDF: 3795 >gi | AC195289.3 | AC195289 | Pan troglodytes BAC clone CH251-716G17 f
IDF: 3795 >gi | AC192344.3 | AC192344 | Pan troglodytes BAC clone CH251-157M8 fr
IDF: 3795 >gi | AC169978.2 | AC169978 | Pan troglodytes chromosome X clone PTB-9
IDF: 659 >gi | LT160002.1 | LT160002 | Macaca fascicularis complete genome, chr
IDF: 649 >gi | AP001711.1 | AP001711 AL163256 | Homo sapiens genomic DNA, chrom
IDF: 632 >gi | LT160001.1 | LT160001 | Macaca fascicularis complete genome, chr
IDF: 575 >gi | AC098675.2 | AC098675 AC034282 | Homo sapiens BAC clone RP11-370
IDF: 565 >gi | AC007314.3 | AC007314 | Homo sapiens BAC clone RP11-74G24 from 2
IDF: 562 >gi | BS000112.1 | BS000112 BA000046 | Pan troglodytes chromosome 22 c
IDF: 504 >gi | AC068205.25 | AC068205 | Homo sapiens chromosome 11, clone RP11-
IDF: 501 >gi | AC206440.2 | AC206440 | Pan troglodytes chromosome X clone CH251
IDF: 499 >gi | AL354861.11 | AL354861 | Human DNA sequence from clone RP11-180I
IDF: 499 >gi | AC157755.2 | AC157755 | Pan troglodytes BAC clone CH251-416M24 f
IDF: 498 >gi | AC087600.21 | AC087600 | Homo sapiens 12q BAC RP11-495C23 (Roswe
IDF: 496 >gi | Z84484.1 | Z84484 | Human DNA sequence from clone RP1-50J22 on c
IDF: 493 >gi | AC147285.3 | AC147285 | Pan troglodytes BAC clone RP43-81J3 from
IDF: 492 >gi | AF099810.1 | AF099810 | Homo sapiens neurexin III-alpha gene, pa
IDF: 490 >gi | AC093124.3 | AC093124 | Papio anubis clone RP41-216E17, complete
IDF: 485 >gi | BA000025.2 | BA000025 AP000502-AP000521 | Homo sapiens genomic D
IDF search time: 1
Fasta results:
Fasta search time 98
The best scores are: opt bits E(969128)
gi | AC192344.3 | AC192344 | Pan troglodytes B (154271) [f] 5840 355.8 7.7e-95
gi | AC169978.2 | AC169978 | Pan troglodytes c (215778) [f] 5840 355.4 1.1e-94
gi | AC195289.3 | AC195289 | Pan troglodytes B (189809) [f] 5840 355.1 1.3e-94
gi | AL133329.11 | AL133329 | Human DNA sequen (109508) [f] 5684 346.7 4.3e-92
gi | AC145336.19 | AC145336 | Pan troglodytes (155318) [f] 1294 95.0 2.5e-16
gi | AC145339.34 | AC145339 | Pan troglodytes (150845) [f] 1294 95.0 2.5e-16
gi | AC159032.2 | AC159032 | Pan troglodytes B (183880) [r] 1294 94.2 4.5e-16
gi | AC200436.3 | AC200436 | Pongo abelii BAC (202873) [f] 1182 88.6 2.2e-14
gi | AC198041.4 | AC198041 | Pongo abelii BAC (200198) [f] 1182 88.6 2.2e-14
gi | AC239452.3 | AC239452 | Chlorocebus aethi (174798) [f] 1105 83.2 9.2e-13